Regulog CscR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | 2 | 2 |
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | 2 | 1 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| cscR |
|
|
|
|
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -136 score = 6.37612 sequence = AAAAGTTAACGTTAACATAA Site: position = -200 score = 5.44952 sequence = TTATGGTAACGTTAACAAAA Gene: KPN_03263: Sucrose utilization transcriptional regulator, LacI family |
|
Gene: PMI2191: Sucrose utilization transcriptional regulator, LacI family |
|
Gene: Spro_2081: Sucrose utilization transcriptional regulator, LacI family |
|
Sucrose utilization transcriptional regulator, LacI family |
| CRON 2. | |||||||||||||
| cscB |
|
|
|
|
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -110 score = 6.37612 sequence = TTATGTTAACGTTAACTTTT Site: position = -46 score = 5.44952 sequence = TTTTGTTAACGTTACCATAA Gene: KPN_03262: Sucrose permease, major facilitator superfamily |
|
*
Proteus mirabilis HI4320 Site: position = -116 score = 6.37612 sequence = ATATGTTAACGTTAACTTTA Site: position = -53 score = 5.87576 sequence = TAGAGTTAACGTTAACATTC Gene: PMI0850: Sucrose permease, major facilitator superfamily |
|
*
Serratia proteamaculans 568 Site: position = -114 score = 6.79899 sequence = AAATGTTAACGTTAACTTTT Site: position = -50 score = 6.3467 sequence = TAAAGTTAACGTTAACAATA Gene: Spro_2083: Sucrose permease, major facilitator superfamily |
|
Sucrose permease, major facilitator superfamily |
| cscA |
|
|
|
|
|
|
Gene: KPN_03261: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
*
Proteus mirabilis HI4320 Site: position = -133 score = 4.90281 sequence = TCCTGATAACGTTAACATAA Site: position = -65 score = 4.62968 sequence = AAATGTTATCGCTAATAAGG Gene: PMI2190: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Gene: Spro_2082: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |