Regulon of CelR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_03248
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - GntR/Others
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 5.4 Sequence: GACTCTGGTATGCCAATGTC Position: -136 Score: 5 Sequence: ATATTTGGGATACCACTGTG Position: -72 Score: 5.6 Sequence: TGTTTTGGTATGCCAAAAGT Locus tag: KPN_03250 Name: celC Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: KPN_03249 Name: celH Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: KPN_03248 Name: celR Funciton: Predicted cellobiose utilization transcriptional repressor, GntR family
	KPN_03250	celC	PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	KPN_03249	celH	Beta-glucosidase (EC 3.2.1.21)
	KPN_03248	celR	Predicted cellobiose utilization transcriptional repressor, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD