Regulog CelR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - GntR/Others
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 3 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 4 | 1 |
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 3 | 1 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| celC |
|
|
*
Enterobacter sp. 638 Site: position = -72 score = 6.08815 sequence = ATTTTTGGTATGCCAATAGT Site: position = -166 score = 5.26594 sequence = GTAAGTGGTATGCCAAAGTG Gene: Ent638_3282: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -111 score = 5.77137 sequence = ATTTTTGGTATGCCAAACGC Site: position = -175 score = 5.57054 sequence = CATATTGGAATTCCAATATT Site: position = -206 score = 5.72045 sequence = GCTTATGGTATGCCAAAAAT Gene: ECA3647: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -136 score = 5.04623 sequence = ATATTTGGGATACCACTGTG Site: position = -167 score = 5.3947 sequence = GACTCTGGTATGCCAATGTC Site: position = -72 score = 5.62678 sequence = TGTTTTGGTATGCCAAAAGT Gene: KPN_03250: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
| celH |
|
|
Gene: Ent638_3281: Beta-glucosidase (EC 3.2.1.21) |
|
Gene: ECA3646: Beta-glucosidase (EC 3.2.1.21) |
|
Gene: KPN_03249: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
| celB |
|
|
|
|
Gene: ECA3645: PTS system, cellobiose-specific IIB component |
|
|
|
|
|
|
|
PTS system, cellobiose-specific IIB component |
| celR |
|
|
Gene: Ent638_3280: Predicted cellobiose utilization transcriptional repressor, GntR family |
|
Gene: ECA3644: Predicted cellobiose utilization transcriptional repressor, GntR family |
|
Gene: KPN_03248: Predicted cellobiose utilization transcriptional repressor, GntR family |
|
|
|
|
|
Predicted cellobiose utilization transcriptional repressor, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |