Regulon of BH1516 in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1516
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:
Regulog:	BH1516 - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.9 Sequence: TCACGTAAACGTTTTCTCTC Position: -32 Score: 6.3 Sequence: TTACGTAAACGTTTTCGTTA Locus tag: BH2903 Name: malL Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
	BH2903	malL	Oligo-1,6-glucosidase (EC 3.2.1.10)
Position: -104 Score: 6.5 Sequence: AAAAGTAAACGTTTTCTTTT Locus tag: BH0413 Name: amyA Funciton: Alpha-amylase protein
	BH0413	amyA	Alpha-amylase protein
Position: -34 Score: 6 Sequence: CACAGAAAACGTTTTCGTTT Locus tag: BH1516 Name: BH1516 Funciton: Putative maltose catabolism transcriptional regulator, LacI family
	BH1516	BH1516	Putative maltose catabolism transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD