Regulog BH1516 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 3 | 1 |
| Bacillus halodurans C-125 | 3 | 3 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH1516 |
|
|
|
Gene: ABC3478: Putative maltose catabolism transcriptional regulator, LacI family |
*
Bacillus halodurans C-125 Site: position = -34 score = 5.96819 sequence = CACAGAAAACGTTTTCGTTT Gene: BH1516: Putative maltose catabolism transcriptional regulator, LacI family |
|
|
|
|
|
Gene: Pjdr2_5046: Putative maltose catabolism transcriptional regulator, LacI family |
Putative maltose catabolism transcriptional regulator, LacI family |
| CRON 2. | ||||||||||||
| msmE |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = 35 score = 6.25033 sequence = TAACGTAAACGTTTACTATA Site: position = 4 score = 5.60251 sequence = ATACGAAAACGTTTACTCCC Gene: ABC3496: Multiple sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
Multiple sugar ABC transporter, substrate-binding protein |
| msmF |
|
|
|
Gene: ABC3497: Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
|
|
|
|
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease protein MsmF |
| msmG |
|
|
|
Gene: ABC3498: Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
|
|
|
|
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease protein MsmG |
| CRON 3. | ||||||||||||
| malL |
Gene: Aflv_2271: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
*
Bacillus halodurans C-125 Site: position = -113 score = 5.87109 sequence = TCACGTAAACGTTTTCTCTC Site: position = -32 score = 6.34609 sequence = TTACGTAAACGTTTTCGTTA Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
|
|
|
|
|
Oligo-1,6-glucosidase (EC 3.2.1.10) |
| CRON 4. | ||||||||||||
| amyA |
|
|
|
Gene: ABC1611: Alpha-amylase protein |
*
Bacillus halodurans C-125 Site: position = -104 score = 6.50111 sequence = AAAAGTAAACGTTTTCTTTT Gene: BH0413: Alpha-amylase protein |
|
|
|
|
|
|
Alpha-amylase protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |