Regulon of Caur_3587 in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_1223
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.5 Sequence: ATATTGATGATCTTCAATAT Locus tag: RoseRS_1224 Name: ubiE Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
	RoseRS_1224	ubiE	SAM-dependent methyltransferase DSY4148 (UbiE paralog)
Position: -22 Score: 6.5 Sequence: ATATTGACATTCTTCAATAT Locus tag: RoseRS_1223 Name: Caur_3587 Funciton: transcriptional regulator, ArsR family
	RoseRS_1223	Caur_3587	transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD