Regulon of Caur_3587 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_2310
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -252 Score: 5.6 Sequence: ATATCGATGATCATCAATAC Locus tag: Rcas_2311 Name: PF0583 Funciton: GCN5-related N-acetyltransferase (GNAT) domain Locus tag: Rcas_2312 Name: ubiE Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
	Rcas_2311	PF0583	GCN5-related N-acetyltransferase (GNAT) domain
	Rcas_2312	ubiE	SAM-dependent methyltransferase DSY4148 (UbiE paralog)
Position: -52 Score: 6.6 Sequence: ATATTGACAATCTTCAATAT Locus tag: Rcas_2310 Name: Caur_3587 Funciton: transcriptional regulator, ArsR family
	Rcas_2310	Caur_3587	transcriptional regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD