Regulon of Caur_3587 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type:	Transcription factor
TF locus tag:	Haur_0112
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -188 Score: 5.9 Sequence: ATATTGATTTTTTTCAATCT Position: -41 Score: 6.3 Sequence: ATATTGAAAATTTTCAATTT Locus tag: Haur_2824 Name: PF07992 Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Haur_2823 Name: MFS Funciton: transporter, major facilitator superfamily (MFS)
	Haur_2824	PF07992	FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Haur_2823	MFS	transporter, major facilitator superfamily (MFS)
Position: -50 Score: 5.5 Sequence: ATATTGAATTAATTCGATAA Locus tag: Haur_0112 Name: Caur_3587 Funciton: transcriptional regulator, ArsR family Locus tag: Haur_0111 Name: PF0583 Funciton: GCN5-related N-acetyltransferase (GNAT) domain Locus tag: Haur_0110 Name: ubiE Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
	Haur_0112	Caur_3587	transcriptional regulator, ArsR family
	Haur_0111	PF0583	GCN5-related N-acetyltransferase (GNAT) domain
	Haur_0110	ubiE	SAM-dependent methyltransferase DSY4148 (UbiE paralog)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD