Regulon of Caur_3587 in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_0492
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.5 Sequence: ATATTGACAATTGTCAATAT Locus tag: Cagg_0492 Name: Caur_3587 Funciton: transcriptional regulator, ArsR family
	Cagg_0492	Caur_3587	transcriptional regulator, ArsR family
Position: -89 Score: 5.9 Sequence: TTATTGATGTATGTCAATAT Locus tag: Cagg_0491 Name: PF07992 Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Cagg_0491	PF07992	FAD-dependent pyridine nucleotide-disulphide oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD