Regulon of AcrR in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_0421, Cagg_2437
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	AcrR - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - TetR
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.9 Sequence: ATTACTTACCGGTCGGTAAGAATT Locus tag: Cagg_2437 Name: acrR Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Locus tag: Cagg_2438 Name: acrA Funciton: Probable multidrug efflux system from RND family, membrane fusion protein Locus tag: Cagg_2439 Name: salX Funciton: ABC transporter related protein SalX Locus tag: Cagg_2440 Name: salY Funciton: Putative cell division protein SalY
	Cagg_2437	acrR	Predicted transcriptional regulator of multidrug efflux transporter, TetR family
	Cagg_2438	acrA	Probable multidrug efflux system from RND family, membrane fusion protein
	Cagg_2439	salX	ABC transporter related protein SalX
	Cagg_2440	salY	Putative cell division protein SalY
Position: -51 Score: 6.1 Sequence: GTTACCGACCGGTCGGTCGGTTTT Locus tag: Cagg_0420 Name: Cagg_0420 Funciton: Multidrug transporter, MFS superfamily Locus tag: Cagg_0421 Name: acrR Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
	Cagg_0420	Cagg_0420	Multidrug transporter, MFS superfamily
	Cagg_0421	acrR	Predicted transcriptional regulator of multidrug efflux transporter, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD