Regulog AcrR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - TetR
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 6 | 2 |
| Chloroflexus sp. Y-400-fl | 5 | 2 |
| Roseiflexus castenholzii DSM 13941 | 5 | 2 |
| Roseiflexus sp. RS-1 | 4 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| acrR |
*2
Chloroflexus aggregans DSM 9485 Gene: Cagg_0421: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Site: position = -44 score = 6.93479 sequence = ATTACTTACCGGTCGGTAAGAATT Gene: Cagg_2437: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
*2
Chloroflexus sp. Y-400-fl Site: position = -48 score = 6.93479 sequence = ATTACTTACCGGTCGGTAAGAATT Gene: Chy400_1090: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Gene: Chy400_3789: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
*
Roseiflexus castenholzii DSM 13941 Site: position = -86 score = 6.68211 sequence = ATTCCTGACCGTTCGGTAAAGTGA Gene: Rcas_0269: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
*
Roseiflexus sp. RS-1 Site: position = -94 score = 6.68211 sequence = ATTCCTGACCGTTCGGTAAAGTGG Gene: RoseRS_0266: Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
|
Predicted transcriptional regulator of multidrug efflux transporter, TetR family |
| acrA |
Gene: Cagg_2438: Probable multidrug efflux system from RND family, membrane fusion protein |
Gene: Chy400_1089: Probable multidrug efflux system from RND family, membrane fusion protein |
Gene: Rcas_0268: Probable multidrug efflux system from RND family, membrane fusion protein |
Gene: RoseRS_0267: Probable multidrug efflux system from RND family, membrane fusion protein |
|
Probable multidrug efflux system from RND family, membrane fusion protein |
| salX |
Gene: Cagg_2439: ABC transporter related protein SalX |
Gene: Chy400_1088: ABC transporter related protein SalX |
Gene: Rcas_0267: ABC transporter related protein SalX |
Gene: RoseRS_0268: ABC transporter related protein SalX |
|
ABC transporter related protein SalX |
| salY |
Gene: Cagg_2440: Putative cell division protein SalY |
Gene: Chy400_1087: Putative cell division protein SalY |
Gene: Rcas_0266: Putative cell division protein SalY |
Gene: RoseRS_0269: Putative cell division protein SalY |
|
Putative cell division protein SalY |
| Cagg_0420 |
*
Chloroflexus aggregans DSM 9485 Site: position = -51 score = 6.10346 sequence = GTTACCGACCGGTCGGTCGGTTTT Gene: Cagg_0420: Multidrug transporter, MFS superfamily |
*
Chloroflexus sp. Y-400-fl Site: position = -54 score = 6.18194 sequence = AATACTTACCGACCGGTCGGTTGG Gene: Chy400_3788: Multidrug transporter, MFS superfamily |
*
Roseiflexus castenholzii DSM 13941 Site: position = -41 score = 6.28301 sequence = ACTCCTTACCGACCGGTAAGGAAA Gene: Rcas_2058: Multidrug transporter, MFS superfamily |
Gene: RoseRS_1778: Multidrug transporter, MFS superfamily |
|
Multidrug transporter, MFS superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |