Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	6	2
Chloroflexus sp. Y-400-fl	5	2
Roseiflexus castenholzii DSM 13941	5	2
Roseiflexus sp. RS-1	4	1
Herpetosiphon aurantiacus ATCC 23779

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
acrR	*2 Chloroflexus aggregans DSM 9485 Gene: Cagg_0421: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Site: position = -44 score = 6.93479 sequence = ATTACTTACCGGTCGGTAAGAATT Gene: Cagg_2437: Predicted transcriptional regulator of multidrug efflux transporter, TetR family	*2 Chloroflexus sp. Y-400-fl Site: position = -48 score = 6.93479 sequence = ATTACTTACCGGTCGGTAAGAATT Gene: Chy400_1090: Predicted transcriptional regulator of multidrug efflux transporter, TetR family Gene: Chy400_3789: Predicted transcriptional regulator of multidrug efflux transporter, TetR family	* Roseiflexus castenholzii DSM 13941 Site: position = -86 score = 6.68211 sequence = ATTCCTGACCGTTCGGTAAAGTGA Gene: Rcas_0269: Predicted transcriptional regulator of multidrug efflux transporter, TetR family	* Roseiflexus sp. RS-1 Site: position = -94 score = 6.68211 sequence = ATTCCTGACCGTTCGGTAAAGTGG Gene: RoseRS_0266: Predicted transcriptional regulator of multidrug efflux transporter, TetR family	Herpetosiphon aurantiacus ATCC 23779	Predicted transcriptional regulator of multidrug efflux transporter, TetR family
acrA	Chloroflexus aggregans DSM 9485 Gene: Cagg_2438: Probable multidrug efflux system from RND family, membrane fusion protein	Chloroflexus sp. Y-400-fl Gene: Chy400_1089: Probable multidrug efflux system from RND family, membrane fusion protein	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0268: Probable multidrug efflux system from RND family, membrane fusion protein	Roseiflexus sp. RS-1 Gene: RoseRS_0267: Probable multidrug efflux system from RND family, membrane fusion protein	Herpetosiphon aurantiacus ATCC 23779	Probable multidrug efflux system from RND family, membrane fusion protein
salX	Chloroflexus aggregans DSM 9485 Gene: Cagg_2439: ABC transporter related protein SalX	Chloroflexus sp. Y-400-fl Gene: Chy400_1088: ABC transporter related protein SalX	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0267: ABC transporter related protein SalX	Roseiflexus sp. RS-1 Gene: RoseRS_0268: ABC transporter related protein SalX	Herpetosiphon aurantiacus ATCC 23779	ABC transporter related protein SalX
salY	Chloroflexus aggregans DSM 9485 Gene: Cagg_2440: Putative cell division protein SalY	Chloroflexus sp. Y-400-fl Gene: Chy400_1087: Putative cell division protein SalY	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0266: Putative cell division protein SalY	Roseiflexus sp. RS-1 Gene: RoseRS_0269: Putative cell division protein SalY	Herpetosiphon aurantiacus ATCC 23779	Putative cell division protein SalY
Cagg_0420	* Chloroflexus aggregans DSM 9485 Site: position = -51 score = 6.10346 sequence = GTTACCGACCGGTCGGTCGGTTTT Gene: Cagg_0420: Multidrug transporter, MFS superfamily	* Chloroflexus sp. Y-400-fl Site: position = -54 score = 6.18194 sequence = AATACTTACCGACCGGTCGGTTGG Gene: Chy400_3788: Multidrug transporter, MFS superfamily	* Roseiflexus castenholzii DSM 13941 Site: position = -41 score = 6.28301 sequence = ACTCCTTACCGACCGGTAAGGAAA Gene: Rcas_2058: Multidrug transporter, MFS superfamily	Roseiflexus sp. RS-1 Gene: RoseRS_1778: Multidrug transporter, MFS superfamily	Herpetosiphon aurantiacus ATCC 23779	Multidrug transporter, MFS superfamily

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD