Regulon of CueR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO1687
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Shewanellaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 26 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.5 Sequence: ACTCTCCCGTGATGGGAGACT Locus tag: SO_1689 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	SO_1689	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD