Regulog CueR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 1 | 1 |
| Shewanella putrefaciens CN-32 | 2 | 2 |
| Shewanella sp W3-18-1 | 2 | 2 |
| Shewanella sp ANA-3 | 2 | 2 |
| Shewanella sp MR-4 | 2 | 2 |
| Shewanella sp MR-7 | 2 | 2 |
| Shewanella baltica OS155 | 2 | 2 |
| Shewanella denitrificans OS217 | 2 | 1 |
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 3 | 2 |
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 2 | 2 |
| Shewanella halifaxensis HAW-EB4 | 2 | 2 |
| Shewanella piezotolerans WP3 | 2 | 2 |
| Shewanella sediminis HAW-EB3 | 2 | 2 |
| Shewanella woodyi ATCC 51908 | 2 | 2 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| copZ |
|
|
|
|
|
|
|
|
|
*
Shewanella amazonensis SB2B Site: position = -114 score = 5.51577 sequence = ACCTTGCCATTATGGGAAGGT Gene: Sama_1787: Copper chaperone |
|
|
|
|
|
|
Copper chaperone |
| CRON 2. | |||||||||||||||||
| copA |
*
Shewanella oneidensis MR-1 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: SO_1689: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella putrefaciens CN-32 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: Sputcn32_1408: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp W3-18-1 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: Sputw3181_2693: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp ANA-3 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: Shewana3_2761: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp MR-4 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: Shewmr4_2587: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sp MR-7 Site: position = -65 score = 6.46434 sequence = ACTCTCCCGTGATGGGAGACT Gene: Shewmr7_2654: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella baltica OS155 Site: position = -65 score = 6.18621 sequence = ACTCTCCCGCAATGGGAGACT Gene: Sbal_1505: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella denitrificans OS217 Site: position = -61 score = 5.13402 sequence = ACCTTACCATGATGGCAAGCT Gene: Sden_3691: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
*
Shewanella amazonensis SB2B Site: position = -67 score = 5.51577 sequence = ACCTTCCCATAATGGCAAGGT Gene: Sama_1786: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
*
Shewanella pealeana ATCC 700345 Site: position = -63 score = 5.10353 sequence = ACTCTCCCCCTGTAGGAGACA Gene: Spea_2772: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -62 score = 5.99392 sequence = ACTCTCCCCTTATGGGAGACA Gene: Shal_2867: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella piezotolerans WP3 Site: position = -73 score = 5.99392 sequence = ACTCTCCCCTTATGGGAGACA Gene: swp_3377: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella sediminis HAW-EB3 Site: position = -80 score = 5.99392 sequence = ACTCTCCCATTAGGGGAGACA Gene: Ssed_1485: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Shewanella woodyi ATCC 51908 Site: position = -81 score = 5.8006 sequence = ACCCTCCCATAAGGGGAGACA Gene: Swoo_3191: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
Gene: SO_1687: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella putrefaciens CN-32 Site: position = -86 score = 6.46434 sequence = AGTCTCCCATCACGGGAGAGT Gene: Sputcn32_1407: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella sp W3-18-1 Site: position = -86 score = 6.46434 sequence = AGTCTCCCATCACGGGAGAGT Gene: Sputw3181_2694: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella sp ANA-3 Site: position = -92 score = 6.46434 sequence = AGTCTCCCATCACGGGAGAGT Gene: Shewana3_2762: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella sp MR-4 Site: position = -104 score = 6.46434 sequence = AGTCTCCCATCACGGGAGAGT Gene: Shewmr4_2588: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella sp MR-7 Site: position = -104 score = 6.46434 sequence = AGTCTCCCATCACGGGAGAGT Gene: Shewmr7_2655: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella baltica OS155 Site: position = -105 score = 6.18621 sequence = AGTCTCCCATTGCGGGAGAGT Gene: Sbal_1504: Copper-responsive transcriptional regulator, MerR family |
Gene: Sden_3690: Copper-responsive transcriptional regulator, MerR family |
|
Gene: Sama_1785: Copper-responsive transcriptional regulator, MerR family |
|
*
Shewanella pealeana ATCC 700345 Site: position = -57 score = 5.10353 sequence = TGTCTCCTACAGGGGGAGAGT Gene: Spea_2773: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -81 score = 5.99392 sequence = TGTCTCCCATAAGGGGAGAGT Gene: Shal_2868: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella piezotolerans WP3 Site: position = -58 score = 5.99392 sequence = TGTCTCCCATAAGGGGAGAGT Gene: swp_3378: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella sediminis HAW-EB3 Site: position = -81 score = 5.99392 sequence = TGTCTCCCCTAATGGGAGAGT Gene: Ssed_1484: Copper-responsive transcriptional regulator, MerR family |
*
Shewanella woodyi ATCC 51908 Site: position = -60 score = 5.8006 sequence = TGTCTCCCCTTATGGGAGGGT Gene: Swoo_3192: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |