Regulon of BfrR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_2954
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.2 Sequence: GTCAATGAACGACCAATCTC Locus tag: Chy400_2954 Name: bfrR Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family Locus tag: Chy400_2953 Name: bfrE Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein Locus tag: Chy400_2952 Name: bfrF Funciton: Fructooligosaccharides ABC transporter, permease protein 1 Locus tag: Chy400_2951 Name: bfrG Funciton: Fructooligosaccharides ABC transporter, permease protein 2 Locus tag: Chy400_2950 Name: bfrA Funciton: Beta-fructosidases (EC 3.2.1.26)
	Chy400_2954	bfrR	Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
	Chy400_2953	bfrE	Fructooligosaccharides ABC transporter, substrate-binding protein
	Chy400_2952	bfrF	Fructooligosaccharides ABC transporter, permease protein 1
	Chy400_2951	bfrG	Fructooligosaccharides ABC transporter, permease protein 2
	Chy400_2950	bfrA	Beta-fructosidases (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD