Profile of regulator BfrR in Chloroflexia
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Regulog: | BfrR - Chloroflexia |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By pathway - Fructooligosaccharides utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Chloroflexus sp. Y-400-fl | |||||
| Chy400_2954 | bfrR | -46 | 6.2 | GTCAATGAACGACCAATCTC | |
| Chloroflexus aggregans DSM 9485 | |||||
| Cagg_3715 | bfrR | -46 | 6.4 | GTCAATGGACGACCAATCTC | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |