Profile of regulator BfrR in Chloroflexia

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Chloroflexia

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Chloroflexus sp. Y-400-fl
	Chy400_2954	bfrR	-46	6.2	GTCAATGAACGACCAATCTC
Chloroflexus aggregans DSM 9485
	Cagg_3715	bfrR	-46	6.4	GTCAATGGACGACCAATCTC

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD