Regulon of MsmR in Brachybacterium faecium DSM 4810

Properties
Regulator type:	Transcription factor
TF locus tag:	Bfae_17790
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	MsmR - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.6 Sequence: GCATCGATTCGAATCGATGC Locus tag: Bfae_17810 Name: thuA Funciton: Trehalose utilization protein Locus tag: Bfae_17800 Name: AAur_3255 Funciton: putative dehydrogenase Locus tag: Bfae_17790 Name: msmR Funciton: Multiple sugar utilization transcriptional regulator MsmR, LacI family
	Bfae_17810	thuA	Trehalose utilization protein
	Bfae_17800	AAur_3255	putative dehydrogenase
	Bfae_17790	msmR	Multiple sugar utilization transcriptional regulator MsmR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD