Regulog MsmR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | 6 | 2 |
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | 6 | 2 |
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | 3 | 1 |
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| msmE |
*
Arthrobacter aurescens TC1 Site: position = -59 score = 6.4015 sequence = TCATCGATACGCATCGTCGA Site: position = -46 score = 6.54515 sequence = TCGTCGATACGCATCGATAA Gene: AAur_3251: Multiple sugar ABC transporter, substrate-binding protein |
|
*
Arthrobacter sp. FB24 Site: position = -48 score = 6.54515 sequence = TTGTCGATACGCATCGATGA Gene: Arth_3465: Multiple sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Multiple sugar ABC transporter, substrate-binding protein |
| msmF |
Gene: AAur_3252: Multiple sugar ABC transporter, permease protein 1 |
|
Gene: Arth_3466: Multiple sugar ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
|
|
Multiple sugar ABC transporter, permease protein 1 |
| msmG |
Gene: AAur_3253: Multiple sugar ABC transporter, permease protein 2 |
|
Gene: Arth_3467: Multiple sugar ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
|
|
Multiple sugar ABC transporter, permease protein 2 |
| thuA |
Gene: AAur_3254: Trehalose utilization protein |
|
Gene: Arth_3468: Trehalose utilization protein |
Gene: Bcav_1145: Trehalose utilization protein |
*
Brachybacterium faecium DSM 4810 Site: position = -47 score = 5.6433 sequence = GCATCGATTCGAATCGATGC Gene: Bfae_17810: Trehalose utilization protein |
|
Gene: CMM_0273: Trehalose utilization protein |
|
|
|
|
|
|
|
Trehalose utilization protein |
| AAur_3255 |
Gene: AAur_3255: putative dehydrogenase |
|
Gene: Arth_3469: putative dehydrogenase |
Gene: Bcav_1146: putative dehydrogenase |
Gene: Bfae_17800: putative dehydrogenase |
|
Gene: CMM_0274: putative dehydrogenase |
|
|
|
|
|
|
|
putative dehydrogenase |
| msmR |
*
Arthrobacter aurescens TC1 Site: position = -75 score = 6.43315 sequence = TTCTCGATGCGCATCGACGA Site: position = -62 score = 6.36638 sequence = TCGACGATACGCATCGACAA Gene: AAur_3250: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
|
*
Arthrobacter sp. FB24 Site: position = -117 score = 6.3887 sequence = TTCTCGATACGCATCGACGA Site: position = -104 score = 6.32192 sequence = TCGACGATACGCATCGATAA Gene: Arth_3464: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
|
Gene: Bfae_17790: Multiple sugar utilization transcriptional regulator MsmR, LacI family |
|
|
|
|
|
|
|
|
|
Multiple sugar utilization transcriptional regulator MsmR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |