Regulon of FruR in Janibacter sp. HTCC2649

Properties
Regulator type:	Transcription factor
TF locus tag:	JNB_11229
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructose utilization
Effector:	Fructose
Regulog:	FruR - Micrococcineae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By effector - Fructose
By pathway - Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 6.5 Sequence: CGATGACAACGTTGTCATGG Position: -42 Score: 6.4 Sequence: CCGTGACATCGTTGTCAGGA Locus tag: JNB_11229 Name: frcR Funciton: Probable fructose utilization transcriptional regulator, LacI-family
	JNB_11229	frcR	Probable fructose utilization transcriptional regulator, LacI-family
Position: -34 Score: 5.9 Sequence: GCATGACAACGTTGTCAACG Locus tag: JNB_11239 Name: sacC Funciton: Levanase (EC 3.2.1.65) Locus tag: JNB_11234 Name: sacC Funciton: Levanase (EC 3.2.1.65)
	JNB_11239	sacC	Levanase (EC 3.2.1.65)
	JNB_11234	sacC	Levanase (EC 3.2.1.65)
Position: -122 Score: 6.4 Sequence: TCCTGACAACGATGTCACGG Position: -44 Score: 6.5 Sequence: CCATGACAACGTTGTCATCG Locus tag: JNB_11224 Name: frcB Funciton: Fructose ABC transporter, substrate-binding component FrcB Locus tag: JNB_11219 Name: frcC Funciton: Fructose ABC transporter, permease component FrcC Locus tag: JNB_11214 Name: frcA Funciton: Fructose ABC transporter, ATP-binding component FrcA
	JNB_11224	frcB	Fructose ABC transporter, substrate-binding component FrcB
	JNB_11219	frcC	Fructose ABC transporter, permease component FrcC
	JNB_11214	frcA	Fructose ABC transporter, ATP-binding component FrcA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD