Regulog FruR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructose utilization |
| Effector: | Fructose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By effector - Fructose
- By pathway - Fructose utilization
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | ||
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | 5 | 2 |
| Janibacter sp. HTCC2649 | 6 | 3 |
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| frcB |
|
|
|
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -131 score = 5.79954 sequence = GGATGACAACGGTGTCACGA Site: position = -52 score = 6.30953 sequence = ACCTGACAACGTTGTCGGGA Gene: CMM_2842: Fructose ABC transporter, substrate-binding component FrcB |
*
Janibacter sp. HTCC2649 Site: position = -122 score = 6.38307 sequence = TCCTGACAACGATGTCACGG Site: position = -44 score = 6.52128 sequence = CCATGACAACGTTGTCATCG Gene: JNB_11224: Fructose ABC transporter, substrate-binding component FrcB |
|
|
|
|
|
|
Fructose ABC transporter, substrate-binding component FrcB |
| frcC |
|
|
|
|
|
|
Gene: CMM_2843: Fructose ABC transporter, permease component FrcC |
Gene: JNB_11219: Fructose ABC transporter, permease component FrcC |
|
|
|
|
|
|
Fructose ABC transporter, permease component FrcC |
| frcA |
|
|
|
|
|
|
Gene: CMM_2844: Fructose ABC transporter, ATP-binding component FrcA |
Gene: JNB_11214: Fructose ABC transporter, ATP-binding component FrcA |
|
|
|
|
|
|
Fructose ABC transporter, ATP-binding component FrcA |
| CRON 2. | |||||||||||||||
| sacC |
|
|
|
|
|
|
|
*2
Janibacter sp. HTCC2649 Site: position = -34 score = 5.85655 sequence = GCATGACAACGTTGTCAACG Gene: JNB_11239: Levanase (EC 3.2.1.65) Gene: JNB_11234: Levanase (EC 3.2.1.65) |
|
|
|
|
|
|
Levanase (EC 3.2.1.65) |
| CRON 3. | |||||||||||||||
| frcR |
|
|
|
|
|
|
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382 Site: position = -81 score = 6.30953 sequence = TCCCGACAACGTTGTCAGGT Site: position = -2 score = 5.79954 sequence = TCGTGACACCGTTGTCATCC Gene: CMM_2841: Probable fructose utilization transcriptional regulator, LacI-family |
*
Janibacter sp. HTCC2649 Site: position = -120 score = 6.52128 sequence = CGATGACAACGTTGTCATGG Site: position = -42 score = 6.38307 sequence = CCGTGACATCGTTGTCAGGA Gene: JNB_11229: Probable fructose utilization transcriptional regulator, LacI-family |
|
|
|
|
|
|
Probable fructose utilization transcriptional regulator, LacI-family |
| scrK |
|
|
|
|
|
|
Gene: CMM_2840: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
|
Fructokinase (EC 2.7.1.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |