Regulon of BPSL1304 in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_1118
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	BPSL1304 - Burkholderia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 6.2 Sequence: GGTCGAAAACGTTTACATCG Locus tag: Bamb_1118 Name: BPSL1304 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Bamb_1117 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Bamb_1116 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Bamb_1115 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Bamb_1114 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Bamb_1113 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
	Bamb_1118	BPSL1304	Predicted sugar utilization transcriptional regulator, LacI family
	Bamb_1117	RSc1791	Predicted sugar ABC transporter, substrate-binding protein
	Bamb_1116	RSc1792	Predicted sugar ABC transporter, permease protein 1
	Bamb_1115	RSc1793	Predicted sugar ABC transporter, permease protein 2
	Bamb_1114	RSc1794	Predicted sugar ABC transporter, ATP-binding protein
	Bamb_1113	RSc1795	3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD