Regulon of Sde_0506 in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_2691
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Sde_0506 - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -243 Score: 6.4 Sequence: AAATGTAACCGTTAGCATTT Position: -82 Score: 6.7 Sequence: AAATGAAACCCGTTACATTT Locus tag: Patl_2690 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: Patl_2689 Name: COG1082 Funciton: Predicted sugar isomerase
	Patl_2690	COG0673	Predicted dehydrogenases and related proteins
	Patl_2689	COG1082	Predicted sugar isomerase
Position: -233 Score: 6.7 Sequence: AAATGTAACGGGTTTCATTT Position: -72 Score: 6.4 Sequence: AAATGCTAACGGTTACATTT Locus tag: Patl_2691 Name: Sde_0506 Funciton: Transcriptional regulator for sugar utilization, LacI family protein Locus tag: Patl_2692 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
	Patl_2691	Sde_0506	Transcriptional regulator for sugar utilization, LacI family protein
	Patl_2692	COG1082	Sugar phosphate isomerases/epimerases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD