Regulog Sde_0506 - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | ||
| Alteromonas macleodii 'Deep ecotype' | 4 | 2 |
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | 4 | 2 |
| Pseudoalteromonas haloplanktis TAC125 | ||
| Pseudoalteromonas tunicata D2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| COG0673 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -89 score = 6.86953 sequence = AAATGTAACGGGTTACATTT Gene: MADE_00430: Predicted dehydrogenases and related proteins |
|
Gene: GHTCC_010100004468: Predicted dehydrogenases and related proteins |
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -243 score = 6.43388 sequence = AAATGTAACCGTTAGCATTT Site: position = -82 score = 6.73842 sequence = AAATGAAACCCGTTACATTT Gene: Patl_2690: Predicted dehydrogenases and related proteins |
|
|
Predicted dehydrogenases and related proteins |
| COG1082 |
|
Gene: MADE_00431: Predicted sugar isomerase |
|
Gene: GHTCC_010100004473: Predicted sugar isomerase |
|
|
Gene: Patl_2689: Predicted sugar isomerase |
|
|
Predicted sugar isomerase |
| CRON 2. | ||||||||||
| Sde_0506 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -122 score = 6.3886 sequence = AAATGAAAACGGTTACATAT Gene: MADE_00429: Transcriptional regulator for sugar utilization, LacI family protein |
|
|
|
|
*
Pseudoalteromonas atlantica T6c Site: position = -233 score = 6.73842 sequence = AAATGTAACGGGTTTCATTT Site: position = -72 score = 6.43388 sequence = AAATGCTAACGGTTACATTT Gene: Patl_2691: Transcriptional regulator for sugar utilization, LacI family protein |
|
|
Transcriptional regulator for sugar utilization, LacI family protein |
| COG1082 |
|
Gene: MADE_00428: Sugar phosphate isomerases/epimerases |
|
|
|
|
Gene: Patl_2692: Sugar phosphate isomerases/epimerases |
|
|
Sugar phosphate isomerases/epimerases |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |