Regulon of PdxR3 in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A2441
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 4.3 Sequence: GATCCACTTCGCTCGAAGTGGATT Position: -141 Score: 5 Sequence: TGGCCAATCGCCTGATAGTGGATC Locus tag: Mpe_A2441 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	Mpe_A2441	pdxR3	Transcriptional regulator, GntR/MocR family
Position: -147 Score: 5 Sequence: GATCCACTATCAGGCGATTGGCCA Position: -71 Score: 4.3 Sequence: AATCCACTTCGAGCGAAGTGGATC Locus tag: Mpe_A2442 Name: COG0596 Funciton: Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) Locus tag: Mpe_A2443 Name: COG0657 Funciton: Esterase/lipase
	Mpe_A2442	COG0596	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily)
	Mpe_A2443	COG0657	Esterase/lipase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD