Regulon of XAC1548 in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt3185
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	XAC1548 - Xanthomonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.5 Sequence: TGGTGTACTACCTTACTACCACACCA Locus tag: Smlt0201 Name: XAC0231 Funciton: hypothetical protein
	Smlt0201	XAC0231	hypothetical protein
Position: -288 Score: 6.5 Sequence: CGGTGTTATAGTTGCATACAACACCA Locus tag: Smlt3185 Name: XAC1548 Funciton: Transcriptional regulator, GntR family Locus tag: Smlt3186 Name: XAC1547 Funciton: ABC transporter, ATP-binding protein Locus tag: Smlt3187 Name: XAC1546 Funciton: ABC transporter, permease protein
	Smlt3185	XAC1548	Transcriptional regulator, GntR family
	Smlt3186	XAC1547	ABC transporter, ATP-binding protein
	Smlt3187	XAC1546	ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD