Regulog XAC1548 - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Stenotrophomonas maltophilia K279a | 4 | 2 |
| Xanthomonas axonopodis pv. citri str. 306 | 4 | 2 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 4 | 2 |
| Xylella fastidiosa 9a5c |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| XAC0231 |
*
Stenotrophomonas maltophilia K279a Site: position = -55 score = 5.4786 sequence = TGGTGTACTACCTTACTACCACACCA Gene: Smlt0201: hypothetical protein |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -54 score = 5.3264 sequence = CGGTGTACTACCTTACTACCACACCA Gene: XAC0231: hypothetical protein |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -54 score = 5.3264 sequence = CGGTGTACTACCTTACTACCACACCA Gene: XCC0210: hypothetical protein |
|
hypothetical protein |
| CRON 2. | |||||
| XAC1548 |
*
Stenotrophomonas maltophilia K279a Site: position = -288 score = 6.48347 sequence = CGGTGTTATAGTTGCATACAACACCA Gene: Smlt3185: Transcriptional regulator, GntR family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -299 score = 6.75406 sequence = CGGTGTTATAGTTGAATACAACACCA Gene: XAC1548: Transcriptional regulator, GntR family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -299 score = 6.32981 sequence = CGGTGTTATAGTTGAATACAAAACCA Gene: XCC1500: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| XAC1547 |
Gene: Smlt3186: ABC transporter, ATP-binding protein |
Gene: XAC1547: ABC transporter, ATP-binding protein |
Gene: XCC1499: ABC transporter, ATP-binding protein |
Gene: XF1602: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| XAC1546 |
Gene: Smlt3187: ABC transporter, permease protein |
Gene: XAC1546: ABC transporter, permease protein |
Gene: XCC1498: ABC transporter, permease protein |
Gene: XF1601: ABC transporter, permease protein |
ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |