Regulon of SgaR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y1619
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -190 Score: 5.9 Sequence: AATTGATAGCGCTATCTGGT Position: -177 Score: 5.9 Sequence: ATCTGGTAGCGCTATCAAAA Position: -156 Score: 6.3 Sequence: TTGTGATAGCGCTATCATTT Locus tag: y1619 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	y1619	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family
Position: -128 Score: 6.3 Sequence: AAATGATAGCGCTATCACAA Position: -107 Score: 5.9 Sequence: TTTTGATAGCGCTACCAGAT Position: -94 Score: 5.9 Sequence: ACCAGATAGCGCTATCAATT Locus tag: y1618 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	y1618	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD