Regulon of SgaR in Photorhabdus luminescens subsp. laumondii TTO1

Properties
Regulator type:	Transcription factor
TF locus tag:	plu1978
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 6.2 Sequence: AAATGATAGCGCTATCTATG Position: -143 Score: 6.3 Sequence: TTGTGATAGCGCTATCATTT Locus tag: plu1978 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	plu1978	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family
Position: -115 Score: 6.3 Sequence: AAATGATAGCGCTATCACAA Position: -81 Score: 6.2 Sequence: CATAGATAGCGCTATCATTT Locus tag: plu1979 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: plu1980 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: plu1981 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	plu1979	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	plu1980	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	plu1981	sgaT	Ascorbate-specific PTS system, EIIC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD