Regulon of SgaR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_01748
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 5.4 Sequence: CTTTGTTAGCGCTAACTTTG Locus tag: KPN_01747 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: KPN_01746 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: KPN_01745 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	KPN_01747	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	KPN_01746	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	KPN_01745	sgaT	Ascorbate-specific PTS system, EIIC component
Position: -138 Score: 5.4 Sequence: CAAAGTTAGCGCTAACAAAG Locus tag: KPN_01748 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	KPN_01748	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD