Regulon of SgaR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_2847
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -129 Score: 6.2 Sequence: ATTTGATAGCGCTATCACAA Position: -95 Score: 5.6 Sequence: GATTGGTAGCGCTATCTTTG Locus tag: Ent638_2846 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: Ent638_2845 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: Ent638_2844 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component Locus tag: Ent638_2843 Name: tktA Funciton: Transketolase, N-terminal section (EC 2.2.1.1) Locus tag: Ent638_2842 Name: tktB Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
	Ent638_2846	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	Ent638_2845	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	Ent638_2844	sgaT	Ascorbate-specific PTS system, EIIC component
	Ent638_2843	tktA	Transketolase, N-terminal section (EC 2.2.1.1)
	Ent638_2842	tktB	Transketolase, C-terminal section (EC 2.2.1.1)
Position: -161 Score: 5.6 Sequence: CAAAGATAGCGCTACCAATC Position: -127 Score: 6.2 Sequence: TTGTGATAGCGCTATCAAAT Locus tag: Ent638_2847 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	Ent638_2847	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD