Regulon of SgaR in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_3025
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -122 Score: 6.1 Sequence: AAATGATAGCGCTATCACGA Position: -88 Score: 5.8 Sequence: ACTAGATAGCGCTACCATTG Locus tag: ETAE_3026 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: ETAE_3027 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: ETAE_3028 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	ETAE_3026	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	ETAE_3027	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	ETAE_3028	sgaT	Ascorbate-specific PTS system, EIIC component
Position: -242 Score: 5.8 Sequence: CAATGGTAGCGCTATCTAGT Position: -208 Score: 6.1 Sequence: TCGTGATAGCGCTATCATTT Locus tag: ETAE_3025 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	ETAE_3025	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD