Regulon of SgaR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_00488
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 34 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 6.1 Sequence: CAAAGATAGCGCTATCAAAA Position: -141 Score: 6.2 Sequence: ATGTGATAGCGCTATCAAAA Locus tag: CKO_00488 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	CKO_00488	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family
Position: -162 Score: 6.2 Sequence: TTTTGATAGCGCTATCACAT Position: -128 Score: 6.1 Sequence: TTTTGATAGCGCTATCTTTG Locus tag: CKO_00489 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: CKO_00490 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: CKO_00491 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component Locus tag: CKO_00492 Name: tktA Funciton: Transketolase, N-terminal section (EC 2.2.1.1) Locus tag: CKO_00493 Name: tktB Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
	CKO_00489	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	CKO_00490	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	CKO_00491	sgaT	Ascorbate-specific PTS system, EIIC component
	CKO_00492	tktA	Transketolase, N-terminal section (EC 2.2.1.1)
	CKO_00493	tktB	Transketolase, C-terminal section (EC 2.2.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD