Regulon of ScrR in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_6046
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 6 Sequence: TTTCCAAATCGGTTTGGATC Position: -111 Score: 5.8 Sequence: AGGCCAAACCGGTTTTGAAG Locus tag: Bphy_6046 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	Bphy_6046	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -73 Score: 5.8 Sequence: CTTCAAAACCGGTTTGGCCT Position: -51 Score: 6 Sequence: GATCCAAACCGATTTGGAAA Locus tag: Bphy_6047 Name: sacB Funciton: Levansucrase (EC 2.4.1.10) Locus tag: Bphy_6048 Name: Bamb_3698 Funciton: Putative transcriptional regulator, GntR family Locus tag: Bphy_6049 Name: scrB Funciton: Sucrose hydrolase (EC 3.2.1.26)
	Bphy_6047	sacB	Levansucrase (EC 2.4.1.10)
	Bphy_6048	Bamb_3698	Putative transcriptional regulator, GntR family
	Bphy_6049	scrB	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD