Regulon of ScrR in Burkholderia mallei ATCC 23344

Properties
Regulator type:	Transcription factor
TF locus tag:	BMAA0467
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -144 Score: 6.8 Sequence: TATCCAAACCGGTTTGGATG Position: -122 Score: 6.1 Sequence: AATTCAAACCGGTTTGGGCG Locus tag: BMAA0467 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	BMAA0467	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -92 Score: 6.1 Sequence: CGCCCAAACCGGTTTGAATT Position: -70 Score: 6.8 Sequence: CATCCAAACCGGTTTGGATA Locus tag: BMAA0466 Name: sacB Funciton: Levansucrase (EC 2.4.1.10) Locus tag: BMAA0465 Name: scrB Funciton: Sucrose hydrolase (EC 3.2.1.26)
	BMAA0466	sacB	Levansucrase (EC 2.4.1.10)
	BMAA0465	scrB	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD