Regulon of ScrR in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_3699
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 6.3 Sequence: TGTCCAAACCGGTTCGGATG Position: -95 Score: 6.3 Sequence: ATTTCAAACCGGTTTGGACG Locus tag: Bamb_3699 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	Bamb_3699	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -94 Score: 6.3 Sequence: CGTCCAAACCGGTTTGAAAT Position: -72 Score: 6.3 Sequence: CATCCGAACCGGTTTGGACA Locus tag: Bamb_3698 Name: sacB Funciton: Levansucrase (EC 2.4.1.10) Locus tag: Bamb_3697 Name: scrB Funciton: Sucrose hydrolase (EC 3.2.1.26)
	Bamb_3698	sacB	Levansucrase (EC 2.4.1.10)
	Bamb_3697	scrB	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD