Regulon of RSc1790 in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	RSc1790 - Ralstonia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6 Sequence: GCATGTAAACGTTTACACCT Locus tag: Rpic_1419 Name: RSc1790 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Rpic_1418 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Rpic_1417 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Rpic_1416 Name: RSc1793 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Rpic_1415 Name: RSc1794 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Rpic_1414 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
	Rpic_1419	RSc1790	Predicted sugar utilization transcriptional regulator, LacI family
	Rpic_1418	RSc1791	Predicted sugar ABC transporter, substrate-binding protein
	Rpic_1417	RSc1792	Predicted sugar ABC transporter, permease protein 1
	Rpic_1416	RSc1793	Predicted sugar ABC transporter, permease protein 2
	Rpic_1415	RSc1794	Predicted sugar ABC transporter, ATP-binding protein
	Rpic_1414	RSc1795	3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD