Regulon of PtxS in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_0061
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Enterobacteriales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.8 Sequence: GTCTGGAACCGGTACCATTT Locus tag: Spro_0060 Name: kguE Funciton: Epimerase KguE Locus tag: Spro_0059 Name: kguK Funciton: 2-ketogluconate kinase (EC 2.7.1.13) Locus tag: Spro_0058 Name: kguT Funciton: 2-ketogluconate transporter Locus tag: Spro_0057 Name: kguD Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
	Spro_0060	kguE	Epimerase KguE
	Spro_0059	kguK	2-ketogluconate kinase (EC 2.7.1.13)
	Spro_0058	kguT	2-ketogluconate transporter
	Spro_0057	kguD	2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD