Regulog PtxS - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | 2-ketogluconate utilization |
| Effector: | 2-keto-D-gluconate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - 2-keto-D-gluconate
- By pathway - 2-ketogluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | 4 | 1 |
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 4 | 1 |
| Erwinia amylovora ATCC 49946 | 4 | 1 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 4 | 1 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | 4 | 1 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| kguE |
*
Citrobacter koseri ATCC BAA-895 Site: position = -55 score = 7.08564 sequence = CTTTGGAACCGGTTCCATCT Gene: CKO_05006: Epimerase KguE |
|
*
Enterobacter sp. 638 Site: position = -57 score = 7.20163 sequence = TTTTGGAACCGGTTCCATCT Gene: Ent638_0170: Epimerase KguE |
*
Erwinia amylovora ATCC 49946 Site: position = -48 score = 7.08564 sequence = CTTTGGAACCGGTTCCATCT Gene: EAM_3438: Epimerase KguE |
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -66 score = 6.89627 sequence = TTATGGAACCGATACCATCT Gene: KPN_03912: Epimerase KguE |
|
|
|
*
Serratia proteamaculans 568 Site: position = -70 score = 6.78028 sequence = GTCTGGAACCGGTACCATTT Gene: Spro_0060: Epimerase KguE |
|
Epimerase KguE |
| kguK |
Gene: CKO_05007: 2-ketogluconate kinase (EC 2.7.1.13) |
|
Gene: Ent638_0169: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: EAM_3439: 2-ketogluconate kinase (EC 2.7.1.13) |
|
|
Gene: KPN_03913: 2-ketogluconate kinase (EC 2.7.1.13) |
|
|
|
Gene: Spro_0059: 2-ketogluconate kinase (EC 2.7.1.13) |
|
2-ketogluconate kinase (EC 2.7.1.13) |
| kguT |
Gene: CKO_05008: 2-ketogluconate transporter |
|
Gene: Ent638_0168: 2-ketogluconate transporter |
Gene: EAM_3440: 2-ketogluconate transporter |
|
|
Gene: KPN_03914: 2-ketogluconate transporter |
|
|
|
Gene: Spro_0058: 2-ketogluconate transporter |
|
2-ketogluconate transporter |
| kguD |
Gene: CKO_05009: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
|
Gene: Ent638_0167: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: EAM_3441: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
|
|
Gene: KPN_03915: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
|
|
|
Gene: Spro_0057: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
|
2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |