Regulon of DR2501 in Deinococcus radiodurans R1

Properties
Regulator type:	Transcription factor
TF locus tag:	DR2501
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	DR2501 - Deinococcus-Thermus
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Deinococcus-Thermus
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6 Sequence: AGACTGAATCGTTTCAGTTG Locus tag: DR2501 Name: DR2501 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	DR2501	DR2501	Predicted sugar utilization transcriptional regulator, LacI family
Position: 55 Score: 6.1 Sequence: CATCTGAAACGATTCAGTCC Locus tag: DR1375 Name: aglA Funciton: putative alpha-glucosidase (EC 3.2.1.20)
	DR1375	aglA	putative alpha-glucosidase (EC 3.2.1.20)
Position: 70 Score: 6 Sequence: CAACTGAAACGATTCAGTCT Locus tag: DR2502 Name: DR2502 Funciton: Predicted sugar permease, MFS family
	DR2502	DR2502	Predicted sugar permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD