Regulon of DR2501 in Deinococcus geothermalis DSM 11300

Properties
Regulator type:	Transcription factor
TF locus tag:	Dgeo_2243
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	DR2501 - Deinococcus-Thermus
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Deinococcus-Thermus
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.9 Sequence: AGGCTAAATCGATTTAGATC Locus tag: Dgeo_2243 Name: DR2501 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Dgeo_2242 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2)
	Dgeo_2243	DR2501	Predicted sugar utilization transcriptional regulator, LacI family
	Dgeo_2242	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)
Position: -55 Score: 5.9 Sequence: GATCTAAATCGATTTAGCCT Locus tag: Dgeo_2244 Name: DR2502 Funciton: Predicted sugar permease, MFS family
	Dgeo_2244	DR2502	Predicted sugar permease, MFS family
Position: -47 Score: 6 Sequence: GAACTGAATCGATTCAGTCG Locus tag: Dgeo_0672 Name: aglA Funciton: putative alpha-glucosidase (EC 3.2.1.20)
	Dgeo_0672	aglA	putative alpha-glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD