Regulon of DR2501 in Deinococcus deserti VCD115

Properties
Regulator type:	Transcription factor
TF locus tag:	Deide_01360
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	DR2501 - Deinococcus-Thermus
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Deinococcus-Thermus
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 6.5 Sequence: GATCTGAAACGTTTCAGATC Locus tag: Deide_01360 Name: DR2501 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Deide_01370 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2)
	Deide_01360	DR2501	Predicted sugar utilization transcriptional regulator, LacI family
	Deide_01370	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)
Position: -51 Score: 6.5 Sequence: GATCTGAAACGTTTCAGATC Locus tag: Deide_01350 Name: DR2502 Funciton: Predicted sugar permease, MFS family
	Deide_01350	DR2502	Predicted sugar permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD