Regulon of PtxS in Ralstonia eutropha H16

Properties
Regulator type:	Transcription factor
TF locus tag:	H16_B1806
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Ralstonia
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 4.9 Sequence: TCGTGAAACTGGTTTCACCG Locus tag: H16_B1806 Name: ptxS Funciton: 2-ketogluconate utilization repressor PtxS, LacI family
	H16_B1806	ptxS	2-ketogluconate utilization repressor PtxS, LacI family
Position: -79 Score: 6.2 Sequence: TCCTGAAACCGGTTTCAAAA Locus tag: H16_B1807 Name: kguS Funciton: Putative 2-ketogluconate ABC transporter, substrate-binding component Locus tag: H16_B1808 Name: kguC Funciton: Putative 2-ketogluconate ABC transporter, permease component Locus tag: H16_B1809 Name: kguB Funciton: Putative 2-ketogluconate ABC transporter, permease component Locus tag: H16_B1810 Name: kguA Funciton: Putative 2-ketogluconate ABC transporter, ATPase component Locus tag: H16_B1811 Name: kguE Funciton: Epimerase KguE Locus tag: H16_B1812 Name: kguK Funciton: 2-ketogluconate kinase EC=2.7.1.13 Locus tag: H16_B1813 Name: kguD Funciton: 2-ketogluconate-6-phosphate reductase EC=1.1.1.43
	H16_B1807	kguS	Putative 2-ketogluconate ABC transporter, substrate-binding component
	H16_B1808	kguC	Putative 2-ketogluconate ABC transporter, permease component
	H16_B1809	kguB	Putative 2-ketogluconate ABC transporter, permease component
	H16_B1810	kguA	Putative 2-ketogluconate ABC transporter, ATPase component
	H16_B1811	kguE	Epimerase KguE
	H16_B1812	kguK	2-ketogluconate kinase EC=2.7.1.13
	H16_B1813	kguD	2-ketogluconate-6-phosphate reductase EC=1.1.1.43

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD