Regulon of PtxS in Ralstonia pickettii 12J

Properties
Regulator type:	Transcription factor
TF locus tag:	Rpic_0693
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 4.8 Sequence: AATTGGAACCGGTTCCATAA Locus tag: Rpic_0689 Name: kguE Funciton: Epimerase KguE Locus tag: Rpic_0690 Name: kguK Funciton: 2-ketogluconate kinase EC=2.7.1.13 Locus tag: Rpic_0691 Name: kguT Funciton: 2-ketogluconate transporter Locus tag: Rpic_0692 Name: kguD Funciton: 2-ketogluconate-6-phosphate reductase EC=1.1.1.43 Locus tag: Rpic_0693 Name: ptxS Funciton: 2-ketogluconate utilization repressor PtxS, LacI family
	Rpic_0689	kguE	Epimerase KguE
	Rpic_0690	kguK	2-ketogluconate kinase EC=2.7.1.13
	Rpic_0691	kguT	2-ketogluconate transporter
	Rpic_0692	kguD	2-ketogluconate-6-phosphate reductase EC=1.1.1.43
	Rpic_0693	ptxS	2-ketogluconate utilization repressor PtxS, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD