Regulon of UxuR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi02121
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Glucuronate utilization
Effector:
Regulog:	UxuR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -391 Score: 7 Sequence: AAATAACAACGTTGTTATTA Position: -326 Score: 6.5 Sequence: AAATAACAACGTTGTTAAAG Position: -277 Score: 6.4 Sequence: TTTTAACAACGTTGTTAAAC Locus tag: BLi02120 Name: uxuP Funciton: Predicted glucuronate TRAP-type transporter, periplasmic component Locus tag: BLi02119 Name: uxuQ Funciton: Predicted glucuronate TRAP-type transporter, small permease component Locus tag: BLi02118 Name: uxuM Funciton: Predicted glucuronate TRAP-type transporter, large permease component Locus tag: BLi02117 Name: aguA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	BLi02120	uxuP	Predicted glucuronate TRAP-type transporter, periplasmic component
	BLi02119	uxuQ	Predicted glucuronate TRAP-type transporter, small permease component
	BLi02118	uxuM	Predicted glucuronate TRAP-type transporter, large permease component
	BLi02117	aguA	Alpha-glucosidase (EC 3.2.1.20)
Position: -201 Score: 6.4 Sequence: GTTTAACAACGTTGTTAAAA Position: -152 Score: 6.5 Sequence: CTTTAACAACGTTGTTATTT Position: -87 Score: 7 Sequence: TAATAACAACGTTGTTATTT Locus tag: BLi02121 Name: uxuR Funciton: Predicted glucuronate utilization transcriptional regulator UxuR, LacI family
	BLi02121	uxuR	Predicted glucuronate utilization transcriptional regulator UxuR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD