Regulon of UxuR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC0302
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Glucuronate utilization
Effector:
Regulog:	UxuR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Glucuronate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 7 Sequence: TTATAACAACGTTGTTATTT Position: -92 Score: 7 Sequence: TTATAACAACGTTGTTATTT Locus tag: ABC0302 Name: uxuR Funciton: Predicted glucuronate utilization transcriptional regulator UxuR, LacI family
	ABC0302	uxuR	Predicted glucuronate utilization transcriptional regulator UxuR, LacI family
Position: -87 Score: 7 Sequence: AAATAACAACGTTGTTATAA Position: -38 Score: 7 Sequence: AAATAACAACGTTGTTATAA Locus tag: ABC0301 Name: uxuP Funciton: Predicted glucuronate TRAP-type transporter, periplasmic component Locus tag: ABC0300 Name: uxuQ Funciton: Predicted glucuronate TRAP-type transporter, small permease component Locus tag: ABC0299 Name: uxuM Funciton: Predicted glucuronate TRAP-type transporter, large permease component Locus tag: ABC0298 Name: aguA Funciton: Alpha-glucosidase (EC 3.2.1.20)
	ABC0301	uxuP	Predicted glucuronate TRAP-type transporter, periplasmic component
	ABC0300	uxuQ	Predicted glucuronate TRAP-type transporter, small permease component
	ABC0299	uxuM	Predicted glucuronate TRAP-type transporter, large permease component
	ABC0298	aguA	Alpha-glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD