Regulon of RbsR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_1097
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Streptomycetaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 6.8 Sequence: CCGTGTAATCGATTCCATGG Locus tag: SGR_1097 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: SGR_1096 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: SGR_1095 Name: rbsBC Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: SGR_1094 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: SGR_1093 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	SGR_1097	rbsR	Transcriptional repressor of ribose utilization, LacI famil
	SGR_1096	rbsA	Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
	SGR_1095	rbsBC	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	SGR_1094	rbsK	Ribokinase (EC 2.7.1.15)
	SGR_1093	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD