Regulon of RbsR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO2745
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Streptomycetaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.8 Sequence: CCGTGTAATCGATTCCACGA Locus tag: SCO2745 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: SCO2746 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: SCO2747 Name: rbsBC Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: SCO2748 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: SCO2749 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	SCO2745	rbsR	Transcriptional repressor of ribose utilization, LacI famil
	SCO2746	rbsA	Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
	SCO2747	rbsBC	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	SCO2748	rbsK	Ribokinase (EC 2.7.1.15)
	SCO2749	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD