Regulon of Bamb_2736 in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_2736
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bamb_2736 - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 6.3 Sequence: ATTGGCGATTTTTCGTCAAC Locus tag: Bamb_2737 Name: SSF51658 Funciton: Xylose isomerase-like, TIM barrel domain Locus tag: Bamb_2738 Name: COG4130 Funciton: Putative inosose isomerase Locus tag: Bamb_2739 Name: Bamb_2739 Funciton: Hypothetical protein Locus tag: Bamb_2740 Name: iolG Funciton: Predicted myo-inositol 2-dehydrogenase
	Bamb_2737	SSF51658	Xylose isomerase-like, TIM barrel domain
	Bamb_2738	COG4130	Putative inosose isomerase
	Bamb_2739	Bamb_2739	Hypothetical protein
	Bamb_2740	iolG	Predicted myo-inositol 2-dehydrogenase
Position: -51 Score: 6.6 Sequence: GTTGACGAAATTTCGCCATC Locus tag: Bamb_2736 Name: Bamb_2736 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	Bamb_2736	Bamb_2736	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD