Regulog Bamb_2736 - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia phymatum STM815 | ||
| Burkholderia cepacia AMMD | 5 | 2 |
| Burkholderia glumae BGR1 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | 4 | 2 |
| Burkholderia vietnamiensis G4 | ||
| Burkholderia xenovorans LB400 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| SSF51658 |
|
*
Burkholderia cepacia AMMD Site: position = -92 score = 6.28597 sequence = ATTGGCGATTTTTCGTCAAC Gene: Bamb_2737: Xylose isomerase-like, TIM barrel domain |
|
|
|
*
Burkholderia sp. 383 Site: position = -27 score = 6.28597 sequence = ATTGGCGATTTTTCGTCAAC Gene: Bcep18194_A6012: Xylose isomerase-like, TIM barrel domain |
|
|
Xylose isomerase-like, TIM barrel domain |
| COG4130 |
|
Gene: Bamb_2738: Putative inosose isomerase |
|
|
|
Gene: Bcep18194_A6013: Putative inosose isomerase |
|
|
Putative inosose isomerase |
| Bamb_2739 |
|
Gene: Bamb_2739: Hypothetical protein |
|
|
|
|
|
|
Hypothetical protein |
| iolG |
Gene: Bphy_1595: Predicted myo-inositol 2-dehydrogenase |
Gene: Bamb_2740: Predicted myo-inositol 2-dehydrogenase |
Gene: bglu_1g21990: Predicted myo-inositol 2-dehydrogenase |
Gene: BMA0918: Predicted myo-inositol 2-dehydrogenase |
Gene: BPSL1989: Predicted myo-inositol 2-dehydrogenase |
Gene: Bcep18194_A6014: Predicted myo-inositol 2-dehydrogenase |
|
Gene: Bxe_A1331: Predicted myo-inositol 2-dehydrogenase |
Predicted myo-inositol 2-dehydrogenase |
| CRON 2. | |||||||||
| Bamb_2736 |
|
*
Burkholderia cepacia AMMD Site: position = -51 score = 6.63952 sequence = GTTGACGAAATTTCGCCATC Gene: Bamb_2736: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
*
Burkholderia sp. 383 Site: position = -77 score = 6.63952 sequence = GTTGACGAAATTTCGCCATC Gene: Bcep18194_A6011: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
Predicted sugar utilization transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |