Regulon of GntR2 in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2705
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	D-gluconate
Regulog:	GntR2 - Bacillales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - D-gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.8 Sequence: TTACTAAATCGATTTACTAA Position: -41 Score: 5.6 Sequence: TTACTAAACCGTTTTAGTTA Locus tag: OB2705 Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family Locus tag: OB2704 Name: PF01380 Funciton: Putative sugar phosphate isomerase, PF01380 family Locus tag: OB2703 Name: kdgA Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14) Locus tag: OB2702 Name: null Funciton: TRAP-type C4-dicarboxylate transport system, periplasmic component Locus tag: OB2701 Name: null Funciton: TRAP-type C4-dicarboxylate transport system, small permease component Locus tag: OB2700 Name: null Funciton: TRAP-type C4-dicarboxylate transport system, large permease component Locus tag: OB2699 Name: null Funciton: Ribose 5-phosphate isomerase A (EC 5.3.1.6) Locus tag: OB2698 Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) Locus tag: OB2697 Name: PF00215 Funciton: Putative sugar-phosphate decarboxylase, PF00215 family
	OB2705	gntR2	Putative gluconate utilization transcriptional repressor GntR, LacI family
	OB2704	PF01380	Putative sugar phosphate isomerase, PF01380 family
	OB2703	kdgA	2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
	OB2702		TRAP-type C4-dicarboxylate transport system, periplasmic component
	OB2701		TRAP-type C4-dicarboxylate transport system, small permease component
	OB2700		TRAP-type C4-dicarboxylate transport system, large permease component
	OB2699		Ribose 5-phosphate isomerase A (EC 5.3.1.6)
	OB2698	kdgK	2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
	OB2697	PF00215	Putative sugar-phosphate decarboxylase, PF00215 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD