Regulon of GntR2 in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK1942
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	D-gluconate
Regulog:	GntR2 - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - D-gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 6.6 Sequence: TTACTAAATCGATTTAGCCC Locus tag: GK1940 Name: null Funciton: GntP family gluconate:proton (H+) symporter
	GK1940		GntP family gluconate:proton (H+) symporter
Position: -92 Score: 6.6 Sequence: TTCCTAAATCGGTTTAGAAA Locus tag: GK2344 Name: gnd Funciton: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
	GK2344	gnd	6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
Position: -36 Score: 6.4 Sequence: GAACTAAATCGATTTAGTCT Locus tag: GK1942 Name: gntR2 Funciton: Putative gluconate utilization transcriptional repressor GntR, LacI family Locus tag: GK1941 Name: gntK Funciton: Gluconokinase (EC 2.7.1.12)
	GK1942	gntR2	Putative gluconate utilization transcriptional repressor GntR, LacI family
	GK1941	gntK	Gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD